Origine des espèces et évolution - Cours de SVT avec Maxicours - Collège

01 49 08 38 00 - appel gratuit de 9h à 18h (hors week-end)

Origine des espèces et évolution

Objectif(s)
Comprendre le rôle de l'ADN dans le fonctionnement des êtres vivants mais aussi dans les mécanismes d'évolution.
1. ADN, point commun entre les espèces
a. La cellule, unité du vivant
La vie est apparue il y a plus de 3 milliards d'années, les tout premiers organismes vivaient sous l'eau et n'étaient constitués que d'une seule cellule.

La cellule est l'unité du vivant : il s'agit d'une membrane à l'intérieur de laquelle se trouve un liquide appelé cytoplasme. Dans ce liquide, selon les espèces, on retrouve des molécules : des organites qui permettent le bon fonctionnement de la cellule.

Doc. 1 : Dessin d'une cellule

Dans toutes les cellules, on trouve de l'ADN : Acide Désoxyribo-Nucléique, qui est porteur de l'information génétique, c'est-à-dire toutes les informations concernant l'être vivant (fonctionnement, critères morphologiques, etc). Ce sont ces informations qui seront transmises à la descendance lors de la reproduction. L'ADN est donc le support de l'hérédité.
La cellule possède toute une machinerie capable de copier cet ADN.


Chaque être vivant est capable de produire sa propre matière mais aussi de copier son ADN, tout être ne pouvant copier son ADN ne peut être considéré comme vivant, ce qui est le cas des virus qui possèdent de l'ADN (ou de l'ARN) mais qui ont besoin d'infecter une cellule vivante qui copiera à sa place l'ADN grâce à sa machinerie.
L'ADN peut être libre dans le cytoplasme (bactéries) ou bien protégé dans le noyau de la cellule (végétaux et animaux) si celle-ci en possède un.
b. Mise en évidence de l'ADN et son rôle
L'ADN fut découvert dans les années 50 mais les scientifiques, même s'ils connaissaient son existence (expériences de Griffith et Avery), avaient du mal à comprendre son rôle. Il était notamment très difficile à l'époque de faire accepter l'idée que l'ADN puisse être le support de l'information génétique et donc de l'hérédité.

Pour mieux comprendre, deux expériences mettent en évidence son rôle dans l'hérédité et sa capacité à être décodé par toutes les cellules des espèces vivantes.

Expérience 1 : Clonage et naissance de Dolly
Doc. 2 : Le clonage

Dans cette expérience, on prélève l'ovocyte non fécondé d'une brebis (1ère, noire) et on lui injecte le noyau d'une cellule d'une autre brebis (2e, blanche).
Un choc électrique provoque les mécanismes de divisions cellulaires.
L'embryon est replacé dans l'utérus d'une mère porteuse (3e brebis).

Résultat
Naissance d'une brebis identique à la deuxième brebis (ayant donné son noyau).

Interprétation

- La mère porteuse n'a pas d'influence sur la génétique de l'embryon.
- C'est le noyau qui contient l'information génétique héritée par l'embryon.
- Toutes les cellules contiennent cette information dans leur noyau.
 
Expérience 2 : La fluorescence

Le gène GFP est un gène codant pour une protéine fluorescente verte. On trouve ce gène naturellement chez une méduse : Aequorea victoria. L'expérience décrite ci-dessous a reçu le prix Nobel de chimie en 2008 pour ses découvertes et ses applications.
 
Doc. 3 : Expérience de la fluorescence

L'expérience consiste à prendre une portion d'ADN codant pour la protéine fluorescente (GFP) et à l'insérer dans un embryon de drosophile. Ces dernières ne sont pas fluorescentes naturellement.

Résultats

La drosophile issue de l'expérience devient vert fluorescente sur certaines parties de son corps.

Interprétation
- L'ADN porte les informations génétiques.
- Chaque partie d'ADN correspond à une spécificité (ici le gène GFP correspond à une protéine fluorescente).
- L'information génétique portée par les gènes peut être lue par toutes les cellules de tous les êtres vivants. Le langage est commun pour tous.

Conclusion des expériences

Ces deux expériences montrent que l'ADN est contenu dans les noyaux des cellules, il est porteur de l'hérédité et est universel à toutes les espèces vivantes.
Ceci nous confirme qu'il existe une origine primordiale commune à toutes les espèces.
2. Classification et évolution des espèces
a. Apparition de nouvelles espèces et évolution
• Comment peut-on arriver à une évolution des espèces ?

Différents mécanismes permettent aux espèces d'évoluer.

Allèle
Extrait de séquence d'ADN
A CTGAGGAAGCTGAGGTTCACTGCGGTGCCCAAGAACCACCAGGCGGTCCGGAACCCGTGA
B CTGAGGAAGCTGAGGTTCACTGCGGTGCCCAAGAACCACCAGGCGGTCCGGAACCCGTGA
O TGAGGAAGCTGAGGTTCACTGCGGTGCCCAAGAACCACCAGGCGGTCCGGAACCCGTGA
Doc. 4 : Comparaison des 3 allèles du gène "groupe sanguin"

On peut voir dans ce tableau qu'il n'y a qu'une différence entre les les allèles A, B et l'allèle O (uniquement sur cet extrait). Il manque une lettre au début de la séquence qui décale toutes les autres lettres. Cela suffit à produire un allèle différent.
 
En effet, au cours de sa vie, l'être vivant copie son ADN et le transmet à ses descendants. Lors de ces mécanismes, des anomalies surviennent. Ces anomalies s'appellent les mutations.
Certaines de ces mutations n'apportent aucun changement, d'autres par contre peuvent apporter des nouvelles caractéristiques.

Par exemple, c'est une mutation qui serait à l'origine de l'apparition des poumons permettant de respirer dans l'air, à une époque où les êtres vivants vivaient exclusivement en milieu marin. Cette mutation a permis à des individus de s'affranchir du milieu aquatique et de vivre sur le continent.

Les nouveaux caractères qui apportent un intérêt (reproduction ou survie) aux êtres vivants vont donc être conservés et transmis à leur descendance. Avec le temps, on arrive à l'apparition de nouvelles espèces qui soit s'ajoutent aux anciennes ou les remplacent car leur nouvelle caractéristique les rend plus performants.
 
L'Homme s'inscrit lui aussi dans ce processus d'évolution. Il possède des caractères partagés avec un ancêtre qui nous est encore inconnu mais qui a existé, et qui était commun à l'Homme et aux grands singes actuels. Chacun a subit différentes mutations et a évolué à sa manière, selon les conditions de vie ou de reproduction, pour aboutir aux espèces que nous connaissons maintenant.

Comment a-t-on pu arriver à une telle variété d'espèces ?

On peut observer au niveau de nos espèces actuelles qu'elles possèdent à la fois des caractères ancestraux et des caractères nouveaux. Il y a donc un lien entre les espèces ancestrales et les nouvelles. Ce lien est l'évolution.
L'évolution est une succession d'apparitions et de disparitions d'espèces ayant subit de nombreuses transformations, toutes liées les unes aux autres.
Une espèce ayant subit des modifications peut soit disparaître soit donner une nouvelle espèce.

L'Homme par exemple, possède des caractères ancestraux communs avec des espèces aujourd'hui disparues, comme l'Homme de Néandertal, mais il possède aussi des caractères communs avec les espèces de singes actuelles.
b. Points communs et différences entre êtres vivants : un début de classification...
Les scientifiques ont très tôt voulu classer les animaux et les végétaux à partir de leurs observations. Ils les ont donc tout d'abord classés sur des critères morphologiques.
Par exemple, on classe facilement les chiens et les chats dans des familles proches puisqu'ils ont des poils et allaitent leurs petits.

Au fil de leurs observations, ils se sont rendu compte que beaucoup d'espèces partagent des critères communs.
L'Homme par exemple, partage les mêmes critères que le chien ou le chat : il a des poils et allaite ses enfants. Il existe donc une origine commune entre l'Homme et ces espèces. Ils ont appelé ce groupe : les mammifères.
Plus on choisi de critères, plus la classification est précise. Notamment, si on observe le développement des embryons, on rajoute un critère mais on remarque que les animaux sont tous très proches.
Doc. 5 : Comparaison du développement d'embryons de poisson, de poule, de lapin et d'humain
 

Avec la découverte de l'ADN s'ajoutent des critères génétiques. On a pu confirmer un lien entre tous les êtres vivants et l'existence d'un ancêtre unique à tous ces êtres. On a aussi pu relier plus finement les espèces entre elles.
En décodant l'ADN, on a pu montrer que l'Homme et le chimpanzé avaient 99 % d'ADN en commun, alors qu'en se basant uniquement sur les critères morphologiques, ils étaient bien plus éloignés. Ce nouveau critère génétique a permis de les rapprocher.

Lorsque tous les critères sont réunis et que l'on a décidé des groupes, on peut construire ce que l'on appelle un arbre d'évolution. Il est appelé "d'évolution" car il ne concerne pas que les espèces actuelles, on peut aussi y intégrer les espèces ancestrales, disparues, car même si on ne les connait pas, on peut supposer qu'elles possédaient des critères communs et les positionner sur l'arbre. Le principe est que plus deux espèces partagent des caractères en commun, plus elles sont proches.

Exemple de l'Homme

On peut classer l'Homme dans le règne animal.
Il possède des cellules avec un noyau et du cytoplasme, il fait partie des eucaryotes.
Il possède une colonne vertébrale et un crâne, c'est un vertébré.
Il a quatre membres terminés par des doigts, c'est un tétrapode.
Comme il allaite et possède des poils, il fait partie des mammifères.
Et enfin, il a un pouce opposable aux autres doigts, c'est donc un primate.

Groupes Homme Coquelicot
E. coli
  Eucaryotes Eucaryotes Bactéries
Règne
Animaux Végétaux  
Embranchement Vertébrés Angiospermes Proteobacteria
  Tétrapodes Euangiospermes  
Classe Mammifères Dicotylédones Gamaproteobacteria
Ordre Primates Papaverales Enterobacteriales
Famille Hominidés Papaveracées Enterobacteries
Genre Homo Papaver Escherichia
Espèce sapiens rhoeas coli
Doc. 6 : Exemples de classification
L'essentiel
L'ADN est contenu dans les noyaux des cellules, il est porteur de l'hérédité et est universel à toutes les espèces vivantes.
Ceci nous confirme qu'il existe une origine primordiale commune à toutes les espèces.

Au cours de sa vie, l'être vivant copie son ADN et le transmet à ses descendants. Lors de ces mécanismes, des anomalies surviennent. Ces "anomalies" s'appellent les mutations.
Certaines de ces mutations n'apportent aucun changement, d'autres par contre peuvent apporter des nouvelles caractéristiques.

On peut observer au niveau des nos espèces actuelles qu'elles possèdent à la fois des caractères ancestraux et des caractères nouveaux. Il y a donc un lien entre les espèces ancestrales et les nouvelles. Ce lien est l'évolution.
L'évolution est une succession d'apparitions et de disparitions d'espèces, toutes liées les unes aux autres.

L'Homme s'inscrit lui aussi dans ce processus d'évolution : il possède des caractères partagés avec un ancêtre qui nous est encore inconnu mais qui a existé, et qui était commun à l'Homme et aux grands singes actuels. Chacun a subit différentes mutations et a évolué à sa manière, selon les conditions de vie ou de reproduction, pour aboutir aux espèces que nous connaissons maintenant.

On peut classer les êtres vivants en tenant compte de différents critères : morphologiques, génétiques, comportementaux... On peut alors construire un arbre d'évolution pouvant réunir toutes les espèces : actuelles, ancestrales, disparues, hypothétiques...

Vous avez déjà mis une note à ce cours.

Découvrez les autres cours offerts par Maxicours !

Découvrez Maxicours

Comment as-tu trouvé ce cours ?

Évalue ce cours !

 

Découvrez
Maxicours

Des profs en ligne

Géographie

Aidez votre enfant à réussir en mathématiques grâce à Maxicours

Des profs en ligne

  • 6j/7 de 17h à 20h
  • Par chat, audio, vidéo
  • Sur les 10 matières principales

Des ressources riches

  • Fiches, vidéos de cours
  • Exercices & corrigés
  • Modules de révisions Bac et Brevet

Des outils ludiques

  • Coach virtuel
  • Quiz interactifs
  • Planning de révision

Des tableaux de bord

  • Suivi de la progression
  • Score d’assiduité
  • Une interface Parents