Le lien entre ADN et protéine - Maxicours

Le lien entre ADN et protéine

Objectifs
  • Comprendre que le code génétique est universel à l’ensemble du monde du vivant.
  • Comprendre la relation entre l'ordre d'enchaînement des nucléotides des gènes contenus dans l'ADN et l'ordre d'association des acides aminés dans les chaînes polypeptidiques.
Points clés
  • Le code génétique est universel.
  • Trois nucléotides, que l’on nomme codon, codent pour un acide aminé.
  • Plusieurs codons codent pour un seul acide aminés, le code génétique est redondant.
  • Un codon code pour seulement un acide aminé, le code génétique est non ambigu.
  • Une mutation peut altérer le fonctionnement d’une protéine.
Pour bien comprendre
  • ADN, nucléotides
  • Protéine, séquence polypeptidique, acide aminé
  • Transgénèse
  • Mutation
1. Un système de correspondance entre gène et polypeptide
a. Gène et polypeptide sont des molécules ordonnées

L'ordre dans lequel sont placés les nucléotides du gène dans l'ADN détermine l'ordre dans lequel les acides aminés s'enchaînent dans la molécule polypeptidique correspondante.

Chaque acide aminé est codé par un ensemble précis de nucléotides. Il existe seulement 4 nucléotides différents : A, T, C, G dans l'ADN (A, U, C, G dans l'ARN), mais on trouve 20 acides aminés distincts dans le monde vivant.

b. La notion de codon

Si chaque nucléotide désignait un acide aminé précis, il n'y aurait que 4 acides aminés identifiés par le système de codage. Si une association de deux nucléotides désignait un acide aminé, il n'y aurait que 4², soit 16 combinaisons possibles.

Des expériences utilisant des polynucléotides artificiels (ARN) de composition connue ont montré que le code génétique était fondé sur la correspondance entre une succession de trois nucléotides et un acide aminé. Chaque triplet de nucléotide codant pour un acide aminé précis est appelé codon. Il existe 43 c'est-à-dire 64 codons différents.

2. Les particularités du code génétique

Le code génétique est universel : la signification des codons est la même dans toutes les cellules de tous les organismes du monde vivant. Il est possible d’obtenir l’expression d’un gène d’une espèce après son transfert dans le génome d’une autre espèce (transgénèse, formation d’OGM).

Le code génétique n'est pas ambigu : un codon ne peut coder qu'un seul acide aminé bien précis parmi les vingt qui existent. Le code génétique est redondant : cela signifie qu'il peut exister plusieurs codons pour désigner un même acide aminé. Il existe des codons remarquables :

  • un codon initiateur de la synthèse protéique AUG qui code pour l’acide aminé méthionine.
  • Il y a trois codons « non sens » ou « codons stop » qui signalent l'arrêt de la synthèse protéique : TAA, TGA, TAG.

Il reste 61 codons qui désignent seulement 20 acides aminés. Cela permet de limiter les effets des mutations et des erreurs de transcription de l'ARN polymérase. Il ne faut pas confondre le code génétique et l'information génétique. Tous les êtres vivants ont le même code génétique, mais chacun possède une information génétique différente.


Code génétique

La mutation de la séquence d’un gène peut conduire à la modification du fonctionnement de la protéine produite. Elle peut conduire à la modification d’un ou plusieurs codons. Si elle modifie la séquence protéique elle est appelée « faux-sens ». Sinon, elle est dite « silencieuse ».

Exemples. La drépanocytose est une maladie génétique qui touche un gène du chromosome 11 codant pour la bêta-globuline(protéine de l’hémoglobine). La mutation du 6e codon par la substitution d’un nucléotide (A par un T) changera un codon, soit un acide aminé (acide glutamique par une valine) sur toute la séquence polypeptidique de la protéine. Cette mutation a des conséquences lourdes pour les individus touchés : anémies, des crises douloureuses et un risque accru d'infections.

Brins non transcrits des gènes codant pour les chaînes bêta de l'hémoglobine humaine.

Chaine normale

(brin non transcrit)

ATGGTGCACCTGACTCCTGAGGAGAAGT MetValHisLeuTyrProGluGluLys

Chaine mutée

(brin non transcrit)

ATGGTGCACCTGACTCCTGTGGAGAAGT MetValHisLeuTyrProValGluLys

Vous avez déjà mis une note à ce cours.

Découvrez les autres cours offerts par Maxicours !

Découvrez Maxicours

Comment as-tu trouvé ce cours ?

Évalue ce cours !

 

quote blanc icon

Découvrez Maxicours

Exerce toi en t’abonnant

Des profs en ligne

  • 6 j/7 de 17 h à 20 h
  • Par chat, audio, vidéo
  • Sur les matières principales

Des ressources riches

  • Fiches, vidéos de cours
  • Exercices & corrigés
  • Modules de révisions Bac et Brevet

Des outils ludiques

  • Coach virtuel
  • Quiz interactifs
  • Planning de révision

Des tableaux de bord

  • Suivi de la progression
  • Score d’assiduité
  • Un compte Parent

Inscrivez-vous à notre newsletter !

Votre adresse e-mail sera exclusivement utilisée pour vous envoyer notre newsletter. Vous pourrez vous désinscrire à tout moment, à travers le lien de désinscription présent dans chaque newsletter. Conformément à la Loi Informatique et Libertés n°78-17 du 6 janvier 1978 modifiée, au RGPD n°2016/679 et à la Loi pour une République numérique du 7 octobre 2016, vous disposez du droit d’accès, de rectification, de limitation, d’opposition, de suppression, du droit à la portabilité de vos données, de transmettre des directives sur leur sort en cas de décès. Vous pouvez exercer ces droits en adressant un mail à : contact-donnees@sejer.fr. Vous avez la possibilité de former une réclamation auprès de l’autorité compétente. En savoir plus sur notre politique de confidentialité